new module: fastaguard#12239
Open
ehsanestaji wants to merge 4 commits into
Open
Conversation
SPPearce
reviewed
Jul 5, 2026
SPPearce
reviewed
Jul 6, 2026
| def fasta = file(workDir.resolve("pass.fa").toString()) | ||
| fasta.text = [ | ||
| ">clean", | ||
| "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT" |
Contributor
There was a problem hiding this comment.
you could probably make this string a bit shorter ;)
SPPearce
reviewed
Jul 6, 2026
| def prefix = task.ext.prefix ?: meta.id | ||
| def args = task.ext.args ?: '--profile assembly --gate pipeline' | ||
| """ | ||
| set +e |
Contributor
There was a problem hiding this comment.
This is not required, it should be set by default.
Suggested change
| set +e |
| task.ext.when == null || task.ext.when | ||
|
|
||
| script: | ||
| def prefix = task.ext.prefix ?: meta.id |
Contributor
There was a problem hiding this comment.
Does this work?
This is what we normally use:
Suggested change
| def prefix = task.ext.prefix ?: meta.id | |
| def prefix = task.ext.prefix ?: ${meta.id} |
|
|
||
| script: | ||
| def prefix = task.ext.prefix ?: meta.id | ||
| def args = task.ext.args ?: '--profile assembly --gate pipeline' |
Contributor
There was a problem hiding this comment.
We don't normally set default args like this. Are they required for the tool to run? Or to run on the test data?
Comment on lines
+35
to
+42
| status=\$? | ||
| set -e | ||
|
|
||
| printf "%s\\n" "\${status}" > ${prefix}.fastaguard.exit_code | ||
|
|
||
| if [ "\${status}" -eq 3 ]; then | ||
| exit "\${status}" | ||
| fi |
Contributor
There was a problem hiding this comment.
What is this for, why are you trying to capture the exit code in this way?
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
| authors: | ||
| - "FastaGuard contributors" |
Contributor
There was a problem hiding this comment.
This should be the author of the nf-core/module (i.e. you)
| def fasta = file(workDir.resolve("pass.fa").toString()) | ||
| fasta.text = [ | ||
| ">clean", | ||
| ("ACGT" * 60) |
Contributor
There was a problem hiding this comment.
Does this work? If so, that's cool.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
2 participants
Add this suggestion to a batch that can be applied as a single commit.This suggestion is invalid because no changes were made to the code.Suggestions cannot be applied while the pull request is closed.Suggestions cannot be applied while viewing a subset of changes.Only one suggestion per line can be applied in a batch.Add this suggestion to a batch that can be applied as a single commit.Applying suggestions on deleted lines is not supported.You must change the existing code in this line in order to create a valid suggestion.Outdated suggestions cannot be applied.This suggestion has been applied or marked resolved.Suggestions cannot be applied from pending reviews.Suggestions cannot be applied on multi-line comments.Suggestions cannot be applied while the pull request is queued to merge.Suggestion cannot be applied right now. Please check back later.
Description
This PR adds a new
FASTAGUARDmodule for FastaGuard, a FASTA preflight and triage tool for assembly and submission-readiness workflows.The module emits HTML, JSON, TSV, MultiQC custom-content JSON, a captured FastaGuard exit-code file, and topic-channel version metadata. PASS/WARN/FAIL/invalid FASTA fixtures are included so blocking FASTA results still preserve report evidence for workflow review.
No existing FastaGuard module, open PR, or open issue was found before opening this PR.
PR checklist
topic: versions.label.Local validation
nf-core modules lint fastaguard- 47 passed, 0 warnings, 0 failures.nf-core modules test fastaguard --profile conda --once --no-prompts- all tests passed.nf-core modules test fastaguard --profile docker --once --no-prompts- all tests passed.nf-core modules test fastaguard --profile singularity- not run locally because Singularity/Apptainer is not installed on this macOS host.