Skip to content

Latest commit

 

History

408 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

vamos: VNTR annotation tool using efficient motif sets

vamos is a tool to perform motif annotation of VNTR sequences from long-read assemblies or mapped long-read BAMs. Variant calls are produced from BAMs by prephasing sequences if no phase information is available, a max-cut heuristic is applied to phase reads. Annotation is then called on consensus sequences constructed from partial-order alignment of reads in each haplotype (or all reads if in an autozygous region).

The motifs used to annotate TR sequences are selected from TR annotations of long-read assemblies. An optimization routine is used to select a subset of motifs from all observed motifs at each locus so that the sequences used for annotation likely reflect true motif variation and not sequencing error.

Vamos guarantees that the encoding sequence is winthin a bounded edit distance of the original sequence for the genomes used to compile the motif database.

For example, a VNTR sequence ACGGT|ACTGT|ACGT may be encoded to a more compact representation: ACGGT|ACGGT|ACGT using efficient motif set [ACGGT, ACGT]. The edit distance between the original VNTR sequence and encoding sequence is 1.

Latest Updates

We have released a version 2.1 of the motif set. This has roughly 1.2m loci and uses an additional motif-harmonization step before efficient motif selection. We additionally supply loci for CHM13.

Getting Started

To install vamos, g++ (>= 8.3.0), htslib, abpoa, edlib and alglib are required. htslib and abpoa can be installed through bioconda. Static libraries libalglib.a and libedlib.a are distributed along with vamos.

Install required libraries through conda

conda create --name vamos python=3.10
conda activate vamos
conda install -c bioconda --file requirements.txt

Or download the latest code from github

git clone https://github.com/ChaissonLab/vamos.git 
cd vamos*/src/ && make

Next you should download a locus list. These are in BED format, with the coordinates of the tandem repeat as the BED coordinates, and the list of observed motifs from the Human Pangenome Reference Consortium given as the extra field.

The latest motif sets as of v2.1 can be downloaded via: https://zenodo.org/records/13263615

Explanation of the motif catalog columns:

Column Explanation
1 Chromosome of the locus
2 Start coordinate of the locus
3 End coordinate of the locus
4 Motifs of the locus to be used for annotation (separated by ",")
5 Version of the motif catalog
6 Type of the locus (VNTR or STR)
7 Period size (bp) of the motif consensus of the locus
8 How much proportion the biggest overlap between the locus and a transposable element takes up the TR locus
9 How much proportion the biggest overlap between the locus and a transposable element takes up the transposable element

For annotation on GRCh38 using the vamos efficient motifs:

curl "https://zenodo.org/records/13263615/files/vamos.effMotifs-0.1.GRCh38.tsv.gz?download=1" > vamos.effMotifs-0.1.GRCh38.tsv.gz; gunzip vamos.effMotifs-0.1.GRCh38.tsv.gz;

For annotation on CHM13 using the vamos efficient motifs

curl "https://zenodo.org/records/13263615/files/vamos.effMotifs-0.1.T2T-CHM13.tsv.gz?download=1" > vamos.effMotifs-0.1.T2T-CHM13.tsv.gz; gunzip vamos.effMotifs-0.1.T2T-CHM13.tsv.gz

Running vamos

For running vamos on a haplotype-resolved assembly:

vamos --contig -b assembly.hap1.mapped_to_grch38.bam -r vamos.effMotifs-0.1.GRCh38.tsv -s sample_name -o assembly.hap1.vcf -t 8
vamos --contig -b assembly.hap2.mapped_to_grch38.bam -r vamos.effMotifs-0.1.GRCh38.tsv -s sample_name -o assembly.hap2.vcf -t 8

For running vamos on aligned reads:

vamos --read -b ../example/demo.aln.bam -r vamos.effMotifs-0.1.GRCh38.tsv -s NA24385_CCS_h1 -o reads.vcf -t 8

If the reads are pre-phased using HapCut or WhatsHap, and contain the HA SAM tag, this phasing will be used to call variants from each haplotype. If the reads are unphased, a max-cut heuristic will be used to prephase reads before calling variants.

Output

vamos generates single-sample diploid vcf (by the --read mode) or haploid vcf (by the --contig mode).

Explanation of the "INFO" field of an output vcf:

Field Explanation
END Ending position of the locus
RU All repeating units (motifs) of the locus ("," separated)
SVTYPE VNTR
ALTANNO_H1 Motif annotations (allels) of haplotyp1, motifs are indexed from "0" as ordered in the "RU" field
LEN_H1 Total count of motifs of haplotyp1 allele
ALTANNO_H2 Motif annotations (allels) of haplotyp2, motifs are indexed from "0" as ordered in the "RU" field
LEN_H2 Total count of motifs of haplotyp2 allele

The following shows example entries of a diploid single-sample vcf file

#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	sample1
chr1	11226	.	N	<VNTR>	.	PASS	END=11462;RU=AGAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGCCCTCTTGCTT,ACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTC,AGAGTGGTGGCCACCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGTCCTCTTGCTT,ACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTACGGACATTGCAGGGTCCTCTTGCTC,ACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTCA;SVTYPE=VNTR;ALTANNO_H1=0,0,4,0;LEN_H1=4;	GT	1/1
chr1	15796	.	N	<VNTR>	.	PASS	END=15849;RU=CTT,CTC,CTG,CAG,CATG;SVTYPE=VNTR;ALTANNO_H1=0,1,2,1,0,2,0,0,0,1,3,0,2,1,0,4,2;LEN_H1=17;ALTANNO_H2=0,1,2,1,0,2,2,2,0,1,3,0,2,1,0,4,2;LEN_H2=17;	GT	1/2

Citing vamos

To cite vamos, you should use: Ren, Jingwen, Bida Gu, and Mark JP Chaisson. "vamos: variable-number tandem repeats annotation using efficient motif sets." Genome Biology 24.1 (2023): 175.

Analysis using vamos output

Please refer to tryvamos for more details.

About

VNTR annotation using motif selection

Resources

Stars

44 stars

Watchers

2 watching

Forks

Releases

Packages

Contributors

Languages